Stem-loop sequence chi-mir-328

AccessionMI0030742 (change log)
DescriptionCapra hircus miR-328 stem-loop
Gene family MIPF0000203; mir-328
Literature search

1 open access papers mention chi-mir-328
(1 sentences)

Stem-loop
   cuguuuc     cu  ag           ga     u     a a    g 
5'        ggagc  gg  cgggggggcag  ggggc caggg g uagu u
          |||||  ||  |||||||||||  ||||| ||||| | ||||  
3'        ccuug  cc  gccuucccguc  ucccg guccc c gucg g
   -----gu     cc  cu           uc     -     - -    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr18: 38015786-38015879 [-]
intergenic
Database links

Mature sequence chi-miR-328-3p

Accession MIMAT0036139
Sequence

61 - 

cuggcccucucugcccuuccgu

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).