Stem-loop sequence chi-mir-376d

AccessionMI0030770 (change log)
DescriptionCapra hircus miR-376d stem-loop
Gene family MIPF0000091; mir-368
Literature search

1 open access papers mention chi-mir-376d
(1 sentences)

Stem-loop
   gggauccauccuc         u    g  a         u         cgg   u 
5'              uuugguauu aaaa gu gauuuuccu cuaugguua   guu g
                ||||||||| |||| || ||||||||| |||||||||   |||  
3'              aaacuauga uuuu ca cuaaaagga gauacuaau   uag g
   --gguuucgucgu         c    a  c         -         ---   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67117225-67117334 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-376d
chi-mir-494chr21: 67108251-67108363 [+]
chi-mir-543chr21: 67110457-67110579 [+]
chi-mir-495chr21: 67111896-67112016 [+]
chi-mir-3958chr21: 67113857-67113960 [+]
chi-mir-376echr21: 67116496-67116601 [+]
chi-mir-376cchr21: 67116853-67116964 [+]
chi-mir-376dchr21: 67117225-67117334 [+]
chi-mir-376bchr21: 67117609-67117712 [+]
chi-mir-376achr21: 67117973-67118087 [+]
chi-mir-1185chr21: 67119939-67120050 [+]
chi-mir-381chr21: 67121597-67121724 [+]
chi-mir-487bchr21: 67122099-67122216 [+]
chi-mir-544chr21: 67124523-67124623 [+]
chi-mir-655chr21: 67125414-67125530 [+]
Database links

Mature sequence chi-miR-376d

Accession MIMAT0036189
Sequence

66 - 

aucauagaggaaaauccacau

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).