Stem-loop sequence chi-mir-380

AccessionMI0030775 (change log)
DescriptionCapra hircus miR-380 stem-loop
Gene family MIPF0000126; mir-379
Literature search

2 open access papers mention chi-mir-380
(3 sentences)

Stem-loop
   -----ccuucccac    cc   a      guu       ga       - ugu 
5'               ggua  uga aagaug   gaccaca  acaugcg c   c
                 ||||  ||| ||||||   |||||||  ||||||| |   u
3'               cuau  acu uucugc   cuggugu  uguaugc g   c
   gacgcugacuuaaa    -a   c      -ac       aa       u uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67103397-67103499 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-380
chi-mir-379chr21: 67100421-67100550 [+]
chi-mir-411achr21: 67101691-67101817 [+]
chi-mir-380chr21: 67103397-67103499 [+]
chi-mir-411bchr21: 67103557-67103658 [+]
chi-mir-1197chr21: 67103896-67104024 [+]
chi-mir-323achr21: 67104063-67104176 [+]
chi-mir-758chr21: 67104376-67104476 [+]
chi-mir-329bchr21: 67105074-67105197 [+]
chi-mir-329achr21: 67105386-67105492 [+]
chi-mir-494chr21: 67108251-67108363 [+]
chi-mir-543chr21: 67110457-67110579 [+]
chi-mir-495chr21: 67111896-67112016 [+]
Database links

Mature sequence chi-miR-380-5p

Accession MIMAT0036197
Sequence

23 - 

augguugaccacagaacaugcgc

 - 45

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-380-3p

Accession MIMAT0036198
Sequence

59 - 

uauguaaugugguccacgucu

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).