Stem-loop sequence chi-mir-3958

AccessionMI0030780 (change log)
DescriptionCapra hircus miR-3958 stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention chi-mir-3958
(2 sentences)

Stem-loop
   -------cu   c ga    uuc            u     au         uua 
5'          ggu u  gaug   gaaaggagguug ccgug  guauuugcu   u
            ||| |  ||||   |||||||||||| |||||  |||||||||    
3'          ccg a  cuac   cuuuucucuagu ggcac  uauagacgg   u
   gaaguucuu   u aa    -uu            u     gu         ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67113857-67113960 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-3958
chi-mir-1197chr21: 67103896-67104024 [+]
chi-mir-323achr21: 67104063-67104176 [+]
chi-mir-758chr21: 67104376-67104476 [+]
chi-mir-329bchr21: 67105074-67105197 [+]
chi-mir-329achr21: 67105386-67105492 [+]
chi-mir-494chr21: 67108251-67108363 [+]
chi-mir-543chr21: 67110457-67110579 [+]
chi-mir-495chr21: 67111896-67112016 [+]
chi-mir-3958chr21: 67113857-67113960 [+]
chi-mir-376echr21: 67116496-67116601 [+]
chi-mir-376cchr21: 67116853-67116964 [+]
chi-mir-376dchr21: 67117225-67117334 [+]
chi-mir-376bchr21: 67117609-67117712 [+]
chi-mir-376achr21: 67117973-67118087 [+]
chi-mir-1185chr21: 67119939-67120050 [+]
chi-mir-381chr21: 67121597-67121724 [+]
chi-mir-487bchr21: 67122099-67122216 [+]
Database links

Mature sequence chi-miR-3958-5p

Accession MIMAT0036205
Sequence

3 - 

ggucugagauguucgaaagg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-3958-3p

Accession MIMAT0036206
Sequence

57 - 

agauauugcacgguugaucucu

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).