Stem-loop sequence chi-mir-411b

AccessionMI0030785 (change log)
DescriptionCapra hircus miR-411b stem-loop
Gene family MIPF0000126; mir-379
Stem-loop
     a  uc    ---u    g     a    c      aaa        gugc 
5' cc uu  gcug    augu gagag uggu gaccau   acguacgu    u
   || ||  ||||    |||| ||||| |||| ||||||   ||||||||     
3' gg ag  cgac    uacg cucuu auca cuggua   uguaugca    u
     -  uc    ugac    a     a    c      cac        guau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67103557-67103658 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-411b
chi-mir-379chr21: 67100421-67100550 [+]
chi-mir-411achr21: 67101691-67101817 [+]
chi-mir-380chr21: 67103397-67103499 [+]
chi-mir-411bchr21: 67103557-67103658 [+]
chi-mir-1197chr21: 67103896-67104024 [+]
chi-mir-323achr21: 67104063-67104176 [+]
chi-mir-758chr21: 67104376-67104476 [+]
chi-mir-329bchr21: 67105074-67105197 [+]
chi-mir-329achr21: 67105386-67105492 [+]
chi-mir-494chr21: 67108251-67108363 [+]
chi-mir-543chr21: 67110457-67110579 [+]
chi-mir-495chr21: 67111896-67112016 [+]
Database links

Mature sequence chi-miR-411b-5p

Accession MIMAT0036215
Sequence

24 - 

uggucgaccauaaaacguacgu

 - 45

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-411b-3p

Accession MIMAT0036216
Sequence

59 - 

uaugucacaugguccacuaau

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).