Stem-loop sequence chi-mir-454

AccessionMI0030799 (change log)
DescriptionCapra hircus miR-454 stem-loop
Gene family MIPF0000174; mir-454
Stem-loop
   -         ------a     uc            ---         ----   --u     g 
5'  cuguuuauu       ccaga  cuagaacccuau   cgauauugu    cuc   gcugu u
    |||||||||       |||||  ||||||||||||   |||||||||    |||   |||||  
3'  gacggguaa       gguuu  gguuuugggaua   guuauaacg    gag   cgaua a
   g         caagaag     gu            uuc         ugau   ucu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr19: 10138115-10138228 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-454
chi-mir-301achr19: 10147765-10147849 [-]
chi-mir-454chr19: 10138115-10138228 [-]
Database links

Mature sequence chi-miR-454-5p

Accession MIMAT0036239
Sequence

23 - 

acccuaucgauauugucucug

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-454-3p

Accession MIMAT0036240
Sequence

63 - 

uagugcaauauugcuuauagggu

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).