Stem-loop sequence chi-mir-758

AccessionMI0030833 (change log)
DescriptionCapra hircus miR-758 stem-loop
Gene family MIPF0000126; mir-379
Stem-loop
   --ccacgugcc       a     --    u      agag    c  uu  u 
5'            uggguac ugagg  uggu gaccag    caca gc  ca u
              ||||||| |||||  |||| ||||||    |||| ||  ||  
3'            aucuaug acucc  auca cugguc    gugu ug  gu u
   guucuccccua       -     ca    c      --ca    u  cc  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67104376-67104476 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-758
chi-mir-379chr21: 67100421-67100550 [+]
chi-mir-411achr21: 67101691-67101817 [+]
chi-mir-380chr21: 67103397-67103499 [+]
chi-mir-411bchr21: 67103557-67103658 [+]
chi-mir-1197chr21: 67103896-67104024 [+]
chi-mir-323achr21: 67104063-67104176 [+]
chi-mir-758chr21: 67104376-67104476 [+]
chi-mir-329bchr21: 67105074-67105197 [+]
chi-mir-329achr21: 67105386-67105492 [+]
chi-mir-494chr21: 67108251-67108363 [+]
chi-mir-543chr21: 67110457-67110579 [+]
chi-mir-495chr21: 67111896-67112016 [+]
chi-mir-3958chr21: 67113857-67113960 [+]
Database links

Mature sequence chi-miR-758

Accession MIMAT0036292
Sequence

58 - 

uuugugaccugguccacuaacc

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).