Stem-loop sequence dsi-mir-2498b

AccessionMI0030850 (change log)
DescriptionDrosophila simulans miR-2498b stem-loop
Stem-loop
   ----      cu          u      gu 
5'     aaaagu  guuaugcuaa guuugu  g
       ||||||  |||||||||| ||||||  u
3'     uuuucg  caauacgguu caaaca  u
   ucau      -c          -      au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2R: 15133515-15133573 [-]
intergenic
Clustered miRNAs
< 10kb from dsi-mir-2498b
dsi-mir-992chr2R: 15134519-15134598 [-]
dsi-mir-991chr2R: 15134391-15134508 [-]
dsi-mir-2498cchr2R: 15134038-15134093 [-]
dsi-mir-2498achr2R: 15133881-15133941 [-]
dsi-mir-2498bchr2R: 15133515-15133573 [-]
dsi-mir-313chr2R: 15132988-15133053 [-]
dsi-mir-312chr2R: 15132849-15132914 [-]
dsi-mir-311chr2R: 15132682-15132767 [-]
dsi-mir-310chr2R: 15132557-15132645 [-]
Database links

Mature sequence dsi-miR-2498b-5p

Accession MIMAT0039105
Sequence

1 - 

aaaagucuguuaugcuaauguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dsi-miR-2498b-3p

Accession MIMAT0039106
Sequence

37 - 

acuuggcauaaccgcuuuuu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).