Stem-loop sequence dya-mir-9681

AccessionMI0030897 (change log)
DescriptionDrosophila yakuba miR-9681 stem-loop
Stem-loop
   --           u a    g    uu 
5'   uuucggacaau c aucu ggcg  g
     ||||||||||| | |||| ||||  c
3'   aagguuuguua g ugga ucgc  u
   ag           u a    g    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr2R: 12724136-12724190 [+]
intergenic
Clustered miRNAs
< 10kb from dya-mir-9681
dya-mir-992chr2R: 12723683-12723748 [+]
dya-mir-991chr2R: 12723801-12723862 [+]
dya-mir-2498chr2R: 12723909-12723977 [+]
dya-mir-9681chr2R: 12724136-12724190 [+]
dya-mir-311bchr2R: 12724551-12724629 [+]
dya-mir-312chr2R: 12724700-12724766 [+]
dya-mir-311achr2R: 12724827-12724906 [+]
dya-mir-310chr2R: 12724935-12725022 [+]
Database links

Mature sequence dya-miR-9681-5p

Accession MIMAT0039168
Sequence

1 - 

uuucggacaauucaaucugggc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dya-miR-9681-3p

Accession MIMAT0039169
Sequence

34 - 

ugagguaguauuguuuggaag

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).