Stem-loop sequence dya-mir-991

AccessionMI0030898 (change log)
DescriptionDrosophila yakuba miR-991 stem-loop
Stem-loop
   --     cc    cuu          uuauu 
5'   uuucc  acuc   gcuuuaauac     u
     |||||  ||||   ||||||||||     u
3'   aaagg  ugag   cgaaauuaug     a
   ug     uu    -ac          cugca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr2R: 12723801-12723862 [+]
intergenic
Clustered miRNAs
< 10kb from dya-mir-991
dya-mir-992chr2R: 12723683-12723748 [+]
dya-mir-991chr2R: 12723801-12723862 [+]
dya-mir-2498chr2R: 12723909-12723977 [+]
dya-mir-9681chr2R: 12724136-12724190 [+]
dya-mir-311bchr2R: 12724551-12724629 [+]
dya-mir-312chr2R: 12724700-12724766 [+]
dya-mir-311achr2R: 12724827-12724906 [+]
dya-mir-310chr2R: 12724935-12725022 [+]
Database links

Mature sequence dya-miR-991-5p

Accession MIMAT0039170
Sequence

1 - 

uuuccccacuccuugcuuua

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dya-miR-991-3p

Accession MIMAT0039171
Sequence

41 - 

uuaaagccagaguuuggaaag

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).