Stem-loop sequence dvi-mir-9698

AccessionMI0030940 (change log)
DescriptionDrosophila virilis miR-9698 stem-loop
Stem-loop
   ---      g      cu        ugcgg 
5'    gaacuc auucuc  cugucaua     a
      |||||| ||||||  ||||||||     c
3'    uuuggg ugggag  gacgguau     g
   ucc      g      -u        caaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13042: 902871-902931 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9698
dvi-mir-9692scaffold_13042: 912386-912483 [-]
dvi-mir-9694scaffold_13042: 907106-907161 [+]
dvi-mir-9693scaffold_13042: 907106-907161 [-]
dvi-mir-975scaffold_13042: 906914-907008 [-]
dvi-mir-976scaffold_13042: 906737-906829 [-]
dvi-mir-977scaffold_13042: 906576-906670 [-]
dvi-mir-9695scaffold_13042: 903358-903445 [-]
dvi-mir-9696bscaffold_13042: 903198-903268 [+]
dvi-mir-9696ascaffold_13042: 903188-903280 [-]
dvi-mir-9697scaffold_13042: 903020-903103 [-]
dvi-mir-9698scaffold_13042: 902871-902931 [-]
dvi-mir-9699scaffold_13042: 902700-902761 [-]
Database links

Mature sequence dvi-miR-9698-5p

Accession MIMAT0039238
Sequence

1 - 

gaacucgauucuccucugucau

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-9698-3p

Accession MIMAT0039239
Sequence

39 - 

uggcagugagggugggguuucc

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).