Stem-loop sequence dvi-mir-9544c

AccessionMI0030964 (change log)
DescriptionDrosophila virilis miR-9544c stem-loop
Stem-loop
   -uu   a a     c       ugu     gu 
5'    ugc c gcggu uuuuuaa   gguuu  u
      ||| | ||||| |||||||   |||||  u
3'    acg g cgcca gaaaauu   cuaag  u
   aac   c c     c       --u     ag 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12970: 9429631-9429694 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9544c
dvi-mir-9544cscaffold_12970: 9429631-9429694 [-]
dvi-mir-9545scaffold_12970: 9429441-9429543 [-]
dvi-mir-9544bscaffold_12970: 9429010-9429070 [+]
dvi-mir-9544ascaffold_12970: 9428974-9429102 [-]
dvi-mir-9709scaffold_12970: 9428722-9428838 [-]
dvi-mir-9541ascaffold_12970: 9428406-9428469 [+]
dvi-mir-9541bscaffold_12970: 9428404-9428468 [-]
dvi-mir-9710scaffold_12970: 9428001-9428064 [-]
dvi-mir-9543ascaffold_12970: 9427846-9427976 [-]
dvi-mir-9711scaffold_12970: 9427098-9427154 [-]
dvi-mir-9720scaffold_12970: 9426838-9426903 [+]
dvi-mir-9712scaffold_12970: 9426825-9426912 [-]
dvi-mir-9714scaffold_12970: 9426640-9426709 [+]
dvi-mir-9713scaffold_12970: 9426638-9426704 [-]
dvi-mir-9721scaffold_12970: 9419681-9419786 [-]
Database links

Mature sequence dvi-miR-9544c-5p

Accession MIMAT0039277
Sequence

1 - 

uuugcacagcggucuuuuuaau

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-9544c-3p

Accession MIMAT0039278
Sequence

44 - 

uaaaagcaccgccgcgcaca

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).