Stem-loop sequence dvi-mir-9710

AccessionMI0030969 (change log)
DescriptionDrosophila virilis miR-9710 stem-loop
Stem-loop
   ---      cac         guau   ---  au 
5'    uuugca   cgggucuuc    acg   ug  u
      ||||||   |||||||||    |||   ||   
3'    aaaugu   gccuagaag    ugc   ac  u
   uua      auc         --gu   caa  gg 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12970: 9428001-9428064 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9710
dvi-mir-9544cscaffold_12970: 9429631-9429694 [-]
dvi-mir-9545scaffold_12970: 9429441-9429543 [-]
dvi-mir-9544bscaffold_12970: 9429010-9429070 [+]
dvi-mir-9544ascaffold_12970: 9428974-9429102 [-]
dvi-mir-9709scaffold_12970: 9428722-9428838 [-]
dvi-mir-9541ascaffold_12970: 9428406-9428469 [+]
dvi-mir-9541bscaffold_12970: 9428404-9428468 [-]
dvi-mir-9710scaffold_12970: 9428001-9428064 [-]
dvi-mir-9543ascaffold_12970: 9427846-9427976 [-]
dvi-mir-9711scaffold_12970: 9427098-9427154 [-]
dvi-mir-9720scaffold_12970: 9426838-9426903 [+]
dvi-mir-9712scaffold_12970: 9426825-9426912 [-]
dvi-mir-9714scaffold_12970: 9426640-9426709 [+]
dvi-mir-9713scaffold_12970: 9426638-9426704 [-]
dvi-mir-9721scaffold_12970: 9419681-9419786 [-]
dvi-mir-9542dscaffold_12970: 9419392-9419452 [-]
dvi-mir-9542ascaffold_12970: 9418994-9419089 [-]
dvi-mir-9542bscaffold_12970: 9418038-9418099 [-]
Database links

Mature sequence dvi-miR-9710-5p

Accession MIMAT0039287
Sequence

1 - 

uuugcacaccgggucuucguau

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-9710-3p

Accession MIMAT0039288
Sequence

42 - 

uggaagauccgcuauguaaaau

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).