Stem-loop sequence gma-MIR398d

AccessionMI0031005 (change log)
DescriptionGlycine max miR398d stem-loop
Gene family MIPF0000107; MIR398
Literature search

15 open access papers mention gma-MIR398d
(66 sentences)

Stem-loop
   a   ua     u  u       c        -ac  auu     ---        u 
5'  uuc  caggg cg ccugaga cacaugaa   ag   caaaa   uacaagca a
    |||  ||||| || ||||||| ||||||||   ||   |||||   ||||||||  
3'  aag  guccc gc ggacucu guguacuu   uc   guuuu   guguucgu u
   -   uc     c  u       u        gac  agu     cca        u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 46102354-46102462 [+]
intergenic
Database links

Mature sequence gma-miR398d

Accession MIMAT0036343
Sequence

84 - 

uguguucucaggucgccccug

 - 104

Get sequence
Evidence experimental; Illumina [1]

References

1