Stem-loop sequence gma-MIR9727

AccessionMI0031007 (change log)
DescriptionGlycine max miR9727 stem-loop
Literature search

1 open access papers mention gma-MIR9727
(1 sentences)

Stem-loop
   u  --             auaa     -au  a    gu           c       -  u     u         a    uc      uug   u     u 
5'  gc  acauauaaaaaau    aagga   aa agau  agaugaaguua ucugagc ac gagag cauauguau gaaa  auuucc   uca cucua u
    ||  |||||||||||||    |||||   || ||||  ||||||||||| ||||||| || ||||| ||||||||| ||||  ||||||   ||| |||||  
3'  cg  uguguguuuuuua    uuccu   uu ucug  ucuacuucaau agacucg ug uucuc guguacaua cuuu  uagagg   agu gagau u
   a  uc             -cca     cac  c    gu           u       c  c     c         -    --      uug   u     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 6410597-6410796 [-]
intergenic
Database links

Mature sequence gma-miR9727

Accession MIMAT0036345
Sequence

40 - 

ugaaguuacucugagcacugag

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1