Stem-loop sequence gma-MIR9747

AccessionMI0031036 (change log)
DescriptionGlycine max miR9747 stem-loop
Literature search

1 open access papers mention gma-MIR9747
(1 sentences)

Stem-loop
   g                          u   a          a           aauugucucauuaaucaaaauucu 
5'  cauuuaaaguauuuaaaucguugcau aau aaaauguccu aaaucaauaaa                        u
    |||||||||||||||||||||||||| ||| |||||||||| |||||||||||                         
3'  guaaauuucauaaauuuaguagcgua uua uuuuacagga uuuaguuauuu                        g
   -                          c   c          g           aaauaaauaaaaagaaaucaacug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 32190614-32190770 [+]
intergenic
Database links

Mature sequence gma-miR9747

Accession MIMAT0036374
Sequence

131 - 

caugcgaugauuuaaauacuuu

 - 152

Get sequence
Evidence experimental; Illumina [1]

References

1