Stem-loop sequence gma-MIR319o

AccessionMI0031039 (change log)
DescriptionGlycine max miR319o stem-loop
Gene family MIPF0000010; MIR159
Literature search

17 open access papers mention gma-MIR319o
(42 sentences)

Stem-loop
   g    u            -     c   u       uuc     auuaaa    u  u        ug   ac           cac   g  c     gcu 
5'  agag gaaggagcuucc uucag cca gcaugga   aaggg      gggu gc ggaguauc  cug  ucauucauaca   aca ua guagu   u
    |||| |||||||||||| ||||| ||| |||||||   |||||      |||| || ||||||||  |||  |||||||||||   ||| || |||||    
3'  ucuu cuuccucgaggg aaguc ggu cgugucu   uucuc      ccca cg uuuuauag  gac  aguaagugugu   ugu au cguua   u
   -    u            g     a   u       cuu     ------    -  -        ug   ga           uaa   g  -     aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 11459824-11460018 [-]
intergenic
Database links

Mature sequence gma-miR319o

Accession MIMAT0036377
Sequence

169 - 

uggacugaaggggagcuccuuc

 - 190

Get sequence
Evidence experimental; Illumina [1]

References

1