Stem-loop sequence gma-MIR9750

AccessionMI0031040 (change log)
DescriptionGlycine max miR9750 stem-loop
Literature search

1 open access papers mention gma-MIR9750
(1 sentences)

Stem-loop
   c    c    -                g          uauuu  ucc          aaagaucuggaucgaggaagcagaa 
5'  auuu agag gcgcguauggacuuac accugaagau     cu   ugaugaagcu                         g
    |||| |||| |||||||||||||||| ||||||||||     ||   ||||||||||                          
3'  uaaa ucuc cguguauaccugaaug uggacuucua     ga   acuacuucga                         g
   -    a    u                -          -uuac  -cc          gaacuucuccucgucaauaugguac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 14495616-14495778 [-]
intergenic
Database links

Mature sequence gma-miR9750-5p

Accession MIMAT0039317
Sequence

9 - 

aggcgcguauggacuuacgacc

 - 30

Get sequence
Evidence experimental; Illumina [2]

Mature sequence gma-miR9750-3p

Accession MIMAT0036378
Sequence

137 - 

uguaaguccauaugugcucucu

 - 158

Get sequence
Evidence experimental; Illumina [1]

References

1
2
PMID:25465409 "An atlas of soybean small RNAs identifies phased siRNAs from hundreds of coding genes" Arikit S, Xia R, Kakrana A, Huang K, Zhai J, Yan Z, Valdes-Lopez O, Prince S, Musket TA, Nguyen HT, Stacey G, Meyers BC Plant Cell. 26:4584-4601(2014).