Stem-loop sequence gma-MIR319p

AccessionMI0031041 (change log)
DescriptionGlycine max miR319p stem-loop
Gene family MIPF0001104; MIR319
Literature search

17 open access papers mention gma-MIR319p
(42 sentences)

Stem-loop
   gaaa            g   c        uca    u a 
5'     ugggaguuccuu cag ccaaagcu   agga g a
       |||||||||||| ||| ||||||||   |||| | a
3'     auccucgaggga guc gguuuugg   uccu c u
   -uuc            a   a        -cg    u u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 22789766-22789844 [+]
intergenic
Database links

Mature sequence gma-miR319p

Accession MIMAT0036379
Sequence

54 - 

uuuuggacugaagggagcucc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1