Stem-loop sequence gma-MIR319q

AccessionMI0031060 (change log)
DescriptionGlycine max miR319q stem-loop
Gene family MIPF0000010; MIR159
Literature search

17 open access papers mention gma-MIR319q
(42 sentences)

Stem-loop
        u            c    c   uu      uauaau      uu     g ugaauuaacugauucauucauacaauaguauucaauua 
5' gagag gaaggaguuucc ucag cca  caugga      gaaaga  ggguu c                                      g
   ||||| |||||||||||| |||| |||  ||||||      ||||||  ||||| |                                      g
3' uuuuu cuuccucgaggg aguc ggu  gugucu      cuuucu  cccaa g                                      g
        -            a    a   uc      ------      cc     g uuauaucuaugauaugagagaaguaaguguguuauaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gma-miR319q

Accession MIMAT0036398
Sequence

159 - 

uggacugaagggagcuccuuc

 - 179

Get sequence
Evidence experimental; Illumina [1]

References

1