Stem-loop sequence ptr-mir-519f

AccessionMI0031110 (change log)
DescriptionPan troglodytes miR-519f stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   ------gcaagaagac       u                 a         g   u 
5'                 cucaggc gugacacucuagaggga gcgcuuucu uuu c
                   ||||||| ||||||||||||||||| ||||||||| |||  
3'                 gaguuug cauugugagauuuuccu cgugaaaga aaa u
   gaaguugcaacgaaaa       u                 a         a   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56099801-56099908 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-519f
ptr-mir-520hchr19: 56089945-56090033 [+]
ptr-mir-521-1chr19: 56096062-56096147 [+]
ptr-mir-522chr19: 56098628-56098713 [+]
ptr-mir-519fchr19: 56099801-56099908 [+]
ptr-mir-527chr19: 56101441-56101526 [+]
ptr-mir-516a-1chr19: 56104159-56104247 [+]
ptr-mir-1283bchr19: 56105638-56105756 [+]
ptr-mir-516a-2chr19: 56108558-56108646 [+]
ptr-mir-519achr19: 56109768-56109853 [+]
Database links

Mature sequence ptr-miR-519f-5p

Accession MIMAT0036456
Sequence

25 - 

cucuagagggaagcgcuuucug

 - 46

Get sequence
Evidence not experimental
Predicted targets

Mature sequence ptr-miR-519f-3p

Accession MIMAT0036457
Sequence

60 - 

aaagugcauccuuuuagagugu

 - 81

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:24126940 "Exploration of miRNA families for hypotheses generation" Kamanu TK, Radovanovic A, Archer JA, Bajic VB Sci Rep. 3:2940(2013).