Stem-loop sequence gga-mir-6635-3

AccessionMI0031112 (change log)
DescriptionGallus gallus miR-6635-3 stem-loop
   ----------------ccucucuuga    ---    u       auca       --- ug   g 
5'                           uguc   cggc gugaagg    gaacagc   g  cuu g
                             ||||   |||| |||||||    |||||||   |  ||| c
3'                           acgg   guug cgcuucu    uuugucg   c  gaa u
   acgaggguucguggguucuucguaag    ugu    u       ---g       ugu gu   g 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gga-miR-6635-5p

Accession MIMAT0025731

20 - 


 - 43

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]


PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).