Stem-loop sequence tch-mir-125a

AccessionMI0031133 (change log)
DescriptionTupaia chinensis miR-125a stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   uc  ug   c    ua        ----  a 
5'   cc  aga ccuu  accuguga    gg u
     ||  ||| ||||  ||||||||    ||  
3'   gg  ucu ggag  uggacacu    cc g
   ga  gu   u    --        ggga  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB321018.1: 123734-123791 [+]
intergenic
Clustered miRNAs
< 10kb from tch-mir-125a
tch-mir-99bKB321018.1: 123097-123153 [+]
tch-let-7eKB321018.1: 123251-123317 [+]
tch-mir-125aKB321018.1: 123734-123791 [+]
Database links

Mature sequence tch-miR-125a-5p

Accession MIMAT0036474
Sequence

1 - 

ucccugagacccuuuaaccugug

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1