Stem-loop sequence tch-let-7a

AccessionMI0031142 (change log)
DescriptionTupaia chinensis let-7a stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   --u   gu              uucuag    acac   u 
5'    aag  aguagauuguauag      gguc    cca c
      |||  ||||||||||||||      ||||    |||  
3'    uuc  ucaucuaacauauc      cuag    ggu a
   ccu   ug              ---uca    --aa   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB320720.1: 3822689-3822763 [+]
intergenic
Database links

Mature sequence tch-let-7a-5p

Accession MIMAT0036483
Sequence

1 - 

uaagguaguagauuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tch-let-7a-3p

Accession MIMAT0036484
Sequence

54 - 

cuauacaaucuacugucuuucc

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1