Stem-loop sequence tch-let-7g

AccessionMI0031177 (change log)
DescriptionTupaia chinensis let-7g stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   --u        a            ugagg    -a  a    a 
5'    gagguagu guuuguacaguu     gucu  ug uacc c
      |||||||| ||||||||||||     ||||  || ||||  
3'    uuccguca cggacaugucaa     uaga  ac augg c
   ccg        c            -----    gg  -    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB367803.1: 1475009-1475087 [+]
intergenic
Database links

Mature sequence tch-let-7g-5p

Accession MIMAT0036519
Sequence

1 - 

ugagguaguaguuuguacaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1