Stem-loop sequence tch-let-7f

AccessionMI0031186 (change log)
DescriptionTupaia chinensis let-7f stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   --u                       ---------       u 
5'    gagguaguagauuguauaguugu         gggguag g
      |||||||||||||||||||||||         ||||||| a
3'    uuccguuaucuaacauaucaaua         ucccauu u
   ccc                       gaggacuug       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB366247.1: 213606-213683 [-]
intergenic
Database links

Mature sequence tch-let-7f-5p

Accession MIMAT0036527
Sequence

1 - 

ugagguaguagauuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1