Stem-loop sequence tch-mir-128

AccessionMI0031200 (change log)
DescriptionTupaia chinensis miR-128 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   --c       uag      cu       u 
5'    ggggccg   cacugu  gagaggu u
      |||||||   ||||||  |||||||  
3'    cucuggc   gugaca  cucuuua a
   uuu       caa      --       c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB368231.1: 2382991-2383046 [+]
intergenic
Database links

Mature sequence tch-miR-128

Accession MIMAT0036541
Sequence

36 - 

ucacagugaaccggucucuuu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1