Stem-loop sequence tch-mir-93

AccessionMI0031290 (change log)
DescriptionTupaia chinensis miR-93 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   ---ca       -     u    g   u  g u 
5'      aagugcu guucg gcag uag gu a u
        ||||||| ||||| |||| ||| || | a
3'      uucacga cgagu cguc auc ca u c
   agccc       u     -    -   -  g c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB320709.1: 105392-105453 [+]
intergenic
Clustered miRNAs
< 10kb from tch-mir-93
tch-mir-93KB320709.1: 105392-105453 [+]
tch-mir-25KB320709.1: 105595-105654 [+]
Database links

Mature sequence tch-miR-93-5p

Accession MIMAT0036617
Sequence

1 - 

caaagugcuguucgugcagguag

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1