Stem-loop sequence tch-let-7e

AccessionMI0031293 (change log)
DescriptionTupaia chinensis let-7e stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   --u   g                u  ----gga  a 
5'    gag uaggagguuguauagu ga       gg c
      ||| |||||||||||||||| ||       ||  
3'    uuc auccuccggcauauca cu       cc a
   ccu   g                -  agaggaa  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB321018.1: 123251-123317 [+]
intergenic
Clustered miRNAs
< 10kb from tch-let-7e
tch-mir-99bKB321018.1: 123097-123153 [+]
tch-let-7eKB321018.1: 123251-123317 [+]
tch-mir-125aKB321018.1: 123734-123791 [+]
Database links

Mature sequence tch-let-7e-5p

Accession MIMAT0036620
Sequence

1 - 

ugagguaggagguuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1