Stem-loop sequence oha-let-7f-1

AccessionMI0031301 (change log)
DescriptionOphiophagus hannah let-7f-1 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ccc c     u   gu               ----      gu au 
5'    c uggga gag  aguagauuguauagu    uuuagg  c  a
      | ||||| |||  |||||||||||||||    ||||||  |   
3'    g auccu uuc  ucaucuaacauauca    agguuc  g  c
   -ga u     -   ug               auag      ug cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01000045.1: 598820-598907 [+]
intergenic
Clustered miRNAs
< 10kb from oha-let-7f-1
oha-let-7f-1AZIM01000045.1: 598820-598907 [+]
oha-mir-98AZIM01000045.1: 599246-599349 [+]
Database links

Mature sequence oha-let-7f-5p

Accession MIMAT0036628
Sequence

11 - 

ugagguaguagauuguauaguu

 - 32

Get sequence
Evidence not experimental

Mature sequence oha-let-7f-1-3p

Accession MIMAT0036629
Sequence

58 - 

uaacuauacaaucuacugucuuuc

 - 81

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).