Stem-loop sequence oha-let-7b

AccessionMI0031305 (change log)
DescriptionOphiophagus hannah let-7b stem-loop
Gene family MIPF0000002; let-7
   - ag     u                     ---------uca      u 
5'  c  caggg gagguaguagguugugugguu            ggguag a
    |  ||||| |||||||||||||||||||||            |||||| a
3'  g  guucc uuccgucauccaacauaucaa            cccguu u
   a ga     -                     uugaggacuaac      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01004035.1: 110037-110128 [+]
Clustered miRNAs
< 10kb from oha-let-7b
oha-let-7a-2AZIM01004035.1: 108548-108634 [+]
oha-let-7bAZIM01004035.1: 110037-110128 [+]
Database links

Mature sequence oha-let-7b-5p

Accession MIMAT0036634

9 - 


 - 30

Get sequence
Evidence not experimental

Mature sequence oha-let-7b-3p

Accession MIMAT0036635

65 - 


 - 85

Get sequence
Evidence not experimental


PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).