Stem-loop sequence oha-mir-128

AccessionMI0031330 (change log)
DescriptionOphiophagus hannah miR-128 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   -   u      uuc       uaa      cu    --g g 
5'  agc guugga   ggggccg   cacugu  gaga   g u
    ||| ||||||   |||||||   ||||||  ||||   |  
3'  ucg cgacuu   cucuggc   gugaca  cucu   c u
   u   u      uuu       caa      --    aua a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01001004.1: 127570-127648 [-]
intergenic
Database links

Mature sequence oha-miR-128-5p

Accession MIMAT0036678
Sequence

13 - 

cggggccguaacacugucuga

 - 33

Get sequence
Evidence not experimental

Mature sequence oha-miR-128-3p

Accession MIMAT0036679
Sequence

48 - 

ucacagugaaccggucucuuuu

 - 69

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).