Stem-loop sequence oha-mir-18a

AccessionMI0031381 (change log)
DescriptionOphiophagus hannah miR-18a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   -uuuu    cu    u   uc   u    a   -  aa u 
5'      uguu  aagg gca  uag gcag uag ug  a a
        ||||  |||| |||  ||| |||| ||| ||  | g
3'      acgg  uucc cgu  auc cguc auc ac  u a
   agaau    uc    u   ga   c    -   u  ga u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01002132.1: 158255-158334 [-]
intergenic
Clustered miRNAs
< 10kb from oha-mir-18a
oha-mir-17AZIM01002132.1: 158388-158479 [-]
oha-mir-18aAZIM01002132.1: 158255-158334 [-]
oha-mir-19aAZIM01002132.1: 158114-158203 [-]
oha-mir-20aAZIM01002132.1: 157971-158048 [-]
oha-mir-19bAZIM01002132.1: 157823-157918 [-]
oha-mir-92a-1AZIM01002132.1: 157713-157800 [-]
Database links

Mature sequence oha-miR-18a-5p

Accession MIMAT0036768
Sequence

10 - 

uaaggugcaucuagugcagauag

 - 32

Get sequence
Evidence not experimental

Mature sequence oha-miR-18a-3p

Accession MIMAT0036769
Sequence

51 - 

acugcccuaagugcuccuucug

 - 72

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).