Stem-loop sequence oha-mir-19a

AccessionMI0031395 (change log)
DescriptionOphiophagus hannah miR-19a stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
   uuuu    u  ucu               --      ---    gg 
5'     gcag cu   guuaguuuugcauag  uugcac   uaca  a
       |||| ||   |||||||||||||||  ||||||   ||||  a
3'     uguc gg   uagucaaaacguauc  aacgug   augu  g
   uuau    c  ugu               ua      uug    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01002132.1: 158114-158203 [-]
intergenic
Clustered miRNAs
< 10kb from oha-mir-19a
oha-mir-17AZIM01002132.1: 158388-158479 [-]
oha-mir-18aAZIM01002132.1: 158255-158334 [-]
oha-mir-19aAZIM01002132.1: 158114-158203 [-]
oha-mir-20aAZIM01002132.1: 157971-158048 [-]
oha-mir-19bAZIM01002132.1: 157823-157918 [-]
oha-mir-92a-1AZIM01002132.1: 157713-157800 [-]
Database links

Mature sequence oha-miR-19a-5p

Accession MIMAT0036795
Sequence

17 - 

uaguuuugcauaguugcacua

 - 37

Get sequence
Evidence not experimental

Mature sequence oha-miR-19a-3p

Accession MIMAT0036796
Sequence

53 - 

ugugcaaaucuaugcaaaacuga

 - 75

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).