Stem-loop sequence oha-mir-19b

AccessionMI0031396 (change log)
DescriptionOphiophagus hannah miR-19b stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
   -uaaa       cuc              -  -      uc    --u     
5'      cacuguu   ugguuaguuuugca gg uuugca  cagc   guau 
        |||||||   |||||||||||||| || ||||||  ||||   ||| g
3'      gugacgg   gucagucaaaacgu cc aaacgu  gucg   caua 
   gaaaa       --u              a  u      --    ucu     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01002132.1: 157823-157918 [-]
intergenic
Clustered miRNAs
< 10kb from oha-mir-19b
oha-mir-17AZIM01002132.1: 158388-158479 [-]
oha-mir-18aAZIM01002132.1: 158255-158334 [-]
oha-mir-19aAZIM01002132.1: 158114-158203 [-]
oha-mir-20aAZIM01002132.1: 157971-158048 [-]
oha-mir-19bAZIM01002132.1: 157823-157918 [-]
oha-mir-92a-1AZIM01002132.1: 157713-157800 [-]
Database links

Mature sequence oha-miR-19b-5p

Accession MIMAT0036797
Sequence

20 - 

aguuuugcagguuugcauccagc

 - 42

Get sequence
Evidence not experimental

Mature sequence oha-miR-19b-3p

Accession MIMAT0036798
Sequence

58 - 

ugugcaaauccaugcaaaacuga

 - 80

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).