Stem-loop sequence oha-mir-20b

AccessionMI0031400 (change log)
DescriptionOphiophagus hannah miR-20b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   uc ug       -ca           g     g   -uug  g 
5'   c  gcagggc   aagugcucaua ugcag uag    ug a
     |  |||||||   ||||||||||| ||||| |||    ||  
3'   g  cguccug   uucacgggugu auguc auc    ac g
   ua gu       acc           a     -   uuaa  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01002644.1: 179551-179635 [+]
intergenic
Clustered miRNAs
< 10kb from oha-mir-20b
oha-mir-18bAZIM01002644.1: 177020-177099 [+]
oha-mir-20bAZIM01002644.1: 179551-179635 [+]
oha-mir-92a-2AZIM01002644.1: 179818-179909 [+]
oha-mir-363AZIM01002644.1: 179985-180068 [+]
Database links

Mature sequence oha-miR-20b-5p

Accession MIMAT0036805
Sequence

14 - 

aaagugcucauagugcaggua

 - 34

Get sequence
Evidence not experimental

Mature sequence oha-miR-20b-3p

Accession MIMAT0036806
Sequence

53 - 

acuguaaugugggcacuucca

 - 73

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).