Stem-loop sequence oha-mir-20a

AccessionMI0031410 (change log)
DescriptionOphiophagus hannah miR-20a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   uccu    c   -a        a        g   u   u 
5'     guag acu  aagugcuu uagugcag uag guu c
       |||| |||  |||||||| |||||||| ||| |||  
3'     cauc uga  uucacgag auuacguc auc uaa a
   -gau    a   aa        g        -   -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01002132.1: 157971-158048 [-]
intergenic
Clustered miRNAs
< 10kb from oha-mir-20a
oha-mir-17AZIM01002132.1: 158388-158479 [-]
oha-mir-18aAZIM01002132.1: 158255-158334 [-]
oha-mir-19aAZIM01002132.1: 158114-158203 [-]
oha-mir-20aAZIM01002132.1: 157971-158048 [-]
oha-mir-19bAZIM01002132.1: 157823-157918 [-]
oha-mir-92a-1AZIM01002132.1: 157713-157800 [-]
Database links

Mature sequence oha-miR-20a-5p

Accession MIMAT0036822
Sequence

12 - 

uaaagugcuuauagugcagguag

 - 34

Get sequence
Evidence not experimental

Mature sequence oha-miR-20a-3p

Accession MIMAT0036823
Sequence

48 - 

acugcauuaggagcacuuaaag

 - 69

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).