Stem-loop sequence oha-mir-429

AccessionMI0031469 (change log)
DescriptionOphiophagus hannah miR-429 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   cugcuugccg  c     - u  c          aau      cuuaau 
5'           gc gaucg c gu uuaccagaca   uuagau      c
             || ||||| | || ||||||||||   ||||||       
3'           cg uuagc g cg aauggucugu   aaucug      u
   ----------  u     u c  u          cau      ucgcua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01000256.1: 137861-137949 [+]
intergenic
Clustered miRNAs
< 10kb from oha-mir-429
oha-mir-200aAZIM01000256.1: 133883-133980 [+]
oha-mir-429AZIM01000256.1: 137861-137949 [+]
Database links

Mature sequence oha-miR-429-5p

Accession MIMAT0036923
Sequence

21 - 

gucuuaccagacaaauuuaga

 - 41

Get sequence
Evidence not experimental

Mature sequence oha-miR-429-3p

Accession MIMAT0036924
Sequence

60 - 

uaauacugucugguaaugccguc

 - 82

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).