Stem-loop sequence oha-mir-99a

AccessionMI0031495 (change log)
DescriptionOphiophagus hannah miR-99a stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   gagu    -        aa         uc   u      gugaa 
5'     gcca auuggcau  acccguaga  cga cuugug     a
       |||| ||||||||  |||||||||  ||| ||||||     u
3'     uggu ugacugug  uggguaucu  gcu gaacac     a
   --ag    c        ac         uu   c      guguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OphHan1.0; GCA_000516915.1) Overlapping transcripts
AZIM01000064.1: 967763-967852 [+]
intergenic
Clustered miRNAs
< 10kb from oha-mir-99a
oha-mir-99aAZIM01000064.1: 967763-967852 [+]
oha-let-7c-3AZIM01000064.1: 971593-971671 [+]
Database links

Mature sequence oha-miR-99a-5p

Accession MIMAT0036964
Sequence

18 - 

aacccguagauccgaucuugug

 - 39

Get sequence
Evidence not experimental

Mature sequence oha-miR-99a-3p

Accession MIMAT0036965
Sequence

55 - 

caagcucguuucuaugggucag

 - 76

Get sequence
Evidence not experimental

References

1
PMID:24297900 "The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system" Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl Proc Natl Acad Sci U S A. 110:20651-20656(2013).