Stem-loop sequence bta-mir-2450d

AccessionMI0031506 (change log)
DescriptionBos taurus miR-2450d stem-loop
Gene family MIPF0000758; mir-2450
Literature search

1 open access papers mention bta-mir-2450d
(1 sentences)

Stem-loop
                     u   ca  cu  -  aua 
5' agaggcgcgugugccuuu cug  ca  ug gu   g
   |||||||||||||||||| |||  ||  || ||    
3' uuuccguguacgcggaga gac  gu  ac cg   a
                     u   ug  ac  a  cuc 
Get sequence
Deep sequencing
22 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr6: 108173970-108174042 [-]
sense
ENSBTAT00000001972 ; HTT-201; intron 21
Clustered miRNAs
< 10kb from bta-mir-2450d
bta-mir-2450cchr6: 108174504-108174575 [-]
bta-mir-2450dchr6: 108173970-108174042 [-]
bta-mir-2450bchr6: 108173861-108173933 [-]
bta-mir-2450achr6: 108173591-108173663 [-]
Database links

Mature sequence bta-miR-2450d

Accession MIMAT0036977
Sequence

46 - 

cauggucaguagaggcgcaugug

 - 68

Get sequence
Deep sequencing21 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:24021155 "Profiling microRNA expression in bovine alveolar macrophages using RNA-seq" Vegh P, Foroushani AB, Magee DA, McCabe MS, Browne JA, Nalpas NC, Conlon KM, Gordon SV, Bradley DG, MacHugh DE, Lynn DJ Vet Immunol Immunopathol. 155:238-244(2013).