miRBase entry: hsa-mir-1244-4

Stem-loop hsa-mir-1244-4


Accession
MI0031511
Symbol
HGNC: MIR1244-4
Description
Homo sapiens hsa-mir-1244-4 precursor miRNA
Gene family
MIPF0000569; mir-1244

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR1244-1 is a tumor suppressor miRNA that is downregulated in cluster 1 of the heatmap analysis, along with PTEN, PSME1, DNAJB1, HSPH1, DEDD2, and PAK1IP1 [PMC8465636]. It is also identified as a miRNA in the 114-disease specific DE ncRNAs [PMC8323253]. The hypermethylation of MIR1244-1 has been associated with tobacco exposure and its impact on foetoplacental angiogenic and growth factors in low-birth-weight newborns of smoking mothers [PMC9571148]. The altered expression of MIR1244-1 may be linked to decreased expression of proteins and key factors for correct placental development [PMC9571148]. Additionally, MIR1244-1 is identified as one of the independent prognostic factors in multivariate Cox regression analysis along with CBX2, CLEC3B, and SLC16A11 [PMC9691390].

References:
[PMC8465636] - Liang H., et al. (2020). Identification of key genes associated with gastric cancer based on DNA methylation data. BMC Medical Genomics. 13(2). doi: 10.1186/s12920-019-0655-y.

[PMC8323253] - Liang H., et al. (2020). Identification of key genes associated with gastric cancer based on DNA methylation data. BMC Medical Genomics. 13(2). doi: 10.1186/s12920-019-0655-y.

[PMC9571148] - Sánchez-Illana Á., et al. (2020). Tobacco exposure induces hypermethylation of miRNAs (MIR7-1, MIR3918) that target angiogenic and growth factors in fetal cord blood. Clinical Epigenetics. 12(1). doi: 10.1186/s13148-020-00910-1.

[PMC9691390] - Zhang Y., et al. (2020). Identification of a 6-gene signature predicting prognosis for colorectal cancer. Cancer Cell International. 20(1). doi: 10.1186/s12935-020-01535-z.

Literature search
7 open access papers mention hsa-mir-1244-4
(17 sentences)

Sequence

61 reads, 16 reads per million, 30 experiments
aucuuauuccgagcauuccaguaacuuuuuuguguauguacuuagcuguacuauAAGUAGUUGGUUUGUAUGAGAUGGUUaaaaa
(((((((.....(((..((((..(((......((((.((((......)))))))))))..))))..)))))))))).........

Structure
---------       uccga   uu    ua   uuuuug    u    uu 
         aucuuau     gca  ccag  acu      ugua guac  a
         |||||||     |||  ||||  |||      |||| ||||   
         UAGAGUA     UGU  GGUU  UGA      Auau caug  g
aaaaaUUGG       -----   UU    GA   ------    -    uc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr12: 12111952-12112036 [+]

Database links

Mature hsa-miR-1244

Accession MIMAT0005896
Description Homo sapiens hsa-miR-1244 mature miRNA
Sequence 55 - AAGUAGUUGGUUUGUAUGAGAUGGUU - 80
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621