![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-941-5 |
||||||||||||
Accession | MI0031520 (change log) | |||||||||||
Symbol | HGNC:MIR941-5 | |||||||||||
Description | Homo sapiens miR-941-5 stem-loop | |||||||||||
Gene family | MIPF0000387; mir-941 | |||||||||||
Literature search |
![]()
9 open access papers mention hsa-mir-941-5 | |||||||||||
Stem-loop |
u u c g c aca - a g 5' g gcacaugugc ca ggcc ggg gcg cc c g | |||||||||| || |||| ||| ||| || | 3' c cguguacacg gu ucgg ccc cgc gg g a a c u g - --a a a a |
|||||||||||
Deep sequencing |
| |||||||||||
Confidence |
Annotation confidence: high
| |||||||||||
Genome context |
|
|||||||||||
Clustered miRNAs |
|
|||||||||||
Database links |
|
Mature sequence hsa-miR-941 |
|
Accession | MIMAT0004984 |
Sequence |
47 - cacccggcugugugcacaugugc - 69 |
Deep sequencing | 87795 reads, 144 experiments |
Evidence | experimental; cloned [1], SOLiD [2] |
References |
|
1 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|
2 |
PMID:19784364
"Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors"
PLoS One. 4:e7192(2009).
|