Stem-loop sequence ssc-mir-9822

AccessionMI0031589 (change log)
DescriptionSus scrofa miR-9822 stem-loop
Stem-loop
   c      cc  a cuc     c  --  ga   a   ac 
5'  augggg  ga g   uccuc ga  cg  cag cag  c
    ||||||  || |   ||||| ||  ||  ||| |||   
3'  ugccuc  cu c   aggag cu  gu  guc guc  c
   -      ac  c -ac     a  ag  ag   c   gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 302681896-302681971 [-]
sense
ENSSSCT00000021339 ; ssc-mir-199b.1-201; exon 1
antisense
ENSSSCT00000006203 ; DNM1-201; intron 17
Clustered miRNAs
< 10kb from ssc-mir-9822
ssc-mir-9822chr1: 302681896-302681971 [-]
ssc-mir-199bchr1: 302681826-302681899 [-]
Database links

Mature sequence ssc-miR-9822-3p

Accession MIMAT0037040
Sequence

44 - 

gccuggauggaucagaggacacc

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).