Stem-loop sequence ssc-mir-9860

AccessionMI0031638 (change log)
DescriptionSus scrofa miR-9860 stem-loop
Literature search

1 open access papers mention ssc-mir-9860
(1 sentences)

Stem-loop
   -       -cucuu     a a   u     g     ug ag 
5'  ggccuuu      gcccg g gcu ggacc cgcgu  c  u
    |||||||      ||||| | ||| ||||| |||||  |   
3'  ucggaag      cgggc c cga cuugg gcgca  g  g
   g       cuccuc     - -   -     a     gu gg 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr7: 106158351-106158431 [-]
intergenic
Database links

Mature sequence ssc-miR-9860-5p

Accession MIMAT0037079
Sequence

11 - 

uugcccgagagcuuggaccgc

 - 31

Get sequence
Deep sequencing9 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).