Stem-loop sequence ata-MIR169g

AccessionMI0031645 (change log)
DescriptionAegilops tauschii miR169g stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

1 open access papers mention ata-MIR169g
(1 sentences)

Stem-loop
   ga   u    c         ug          c  a     -   cauca 
5'   cua ggug agccaagga  acuugccgau ga caaug aua     u
     ||| |||| |||||||||  |||||||||| || ||||| |||     c
3'   gau cuac ucgguucuu  ugagcggcua cu guuac uau     a
   uc   u    a         gu          c  a     a   acuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr3: 163502916-163503017 [+]
intergenic
Database links

Mature sequence ata-miR169g-5p

Accession MIMAT0037086
Sequence

11 - 

cagccaaggaugacuugccga

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR169g-3p

Accession MIMAT0037087
Sequence

74 - 

ggcgaguuguucuuggcuaca

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).