Stem-loop sequence ata-MIR167c

AccessionMI0031646 (change log)
DescriptionAegilops tauschii miR167c stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

1 open access papers mention ata-MIR167c
(12 sentences)

Stem-loop
   -  u   u      a    c   -         c uuu       uuc 
5'  ug gaa gaguga gcug cag caugaucua c   gauucgc   u
    || ||| |||||| |||| ||| ||||||||| |   |||||||    
3'  ac cuu uuuacu cgac guc guacuagau g   cuaagug   g
   g  c   c      c    a   a         u uuc       ugc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr5: 62968615-62968710 [-]
intergenic
Clustered miRNAs
< 10kb from ata-MIR167c
ata-MIR167cchr5: 62968615-62968710 [-]
ata-MIR167bchr5: 62966137-62966233 [-]
Database links

Mature sequence ata-miR167c-5p

Accession MIMAT0037088
Sequence

11 - 

ugaagcugccagcaugaucua

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR167c-3p

Accession MIMAT0037089
Sequence

66 - 

gaucaugacugacagccucauu

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).