Stem-loop sequence ata-MIR396a

AccessionMI0031647 (change log)
DescriptionAegilops tauschii miR396a stem-loop
Gene family MIPF0000047; MIR396
Literature search

1 open access papers mention ata-MIR396a
(1 sentences)

Stem-loop
   --  c    cuc    ca                    -uc   c  gccggccauccauggccuuccuuugcugccgaauucgcau 
5'   gg caug   ucca  ggcuuucuugaacugucaac   gcg gc                                        a
     || ||||   ||||  ||||||||||||||||||||   ||| ||                                        u
3'   cc guac   aggu  cugaaagaacuugguaguug   cgu cg                                        g
   cg  c    aaa    uc                    uuc   c  ucucuagguagccuagcgugcucuagcucuguacguucuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
AOCO02019250.1: 2568334-2568507 [+]
intergenic
Database links

Mature sequence ata-miR396a-5p

Accession MIMAT0037090
Sequence

11 - 

uccacaggcuuucuugaacug

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR396a-3p

Accession MIMAT0037091
Sequence

144 - 

guucaagaaaguccuuggaaa

 - 164

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).