Stem-loop sequence ata-MIR393

AccessionMI0031650 (change log)
DescriptionAegilops tauschii miR393 stem-loop
Gene family MIPF0000083; MIR393
Stem-loop
   -u                     c       ----       cu -   c 
5'   aguggaggauuccaaagggau gcauuga    ucgaucu  c cgu a
     ||||||||||||||||||||| |||||||    |||||||  | ||| u
3'   ucgccucuuaagguuucccua cgugacu    agcugga  g gcg c
   gc                     a       aggu       ac u   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr2: 547638879-547638975 [+]
intergenic
Database links

Mature sequence ata-miR393-5p

Accession MIMAT0037096
Sequence

11 - 

uuccaaagggaucgcauugau

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR393-3p

Accession MIMAT0037097
Sequence

68 - 

cagugcaaucccuuuggaauu

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).