Stem-loop sequence ata-MIR160b

AccessionMI0031653 (change log)
DescriptionAegilops tauschii miR160b stem-loop
Gene family MIPF0000032; MIR160
Stem-loop
   ugaua        c   c   c         cu    -   a   ac     uu 
5'      ugaugugc ugg ucc uguaugcca  cauc cag gca  accuu  g
        |||||||| ||| ||| |||||||||  |||| ||| |||  |||||  c
3'      gcuauacg acc agg acgugcggu  guag guc cgu  uggaa  a
   cccaa        a   u   c         ag    c   -   --     ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr7: 246894274-246894380 [+]
intergenic
Database links

Mature sequence ata-miR160b-5p

Accession MIMAT0037102
Sequence

11 - 

ugccuggcucccuguaugcca

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR160b-3p

Accession MIMAT0037103
Sequence

79 - 

gcgugcacggauccaagcaua

 - 99

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).