Stem-loop sequence ata-MIR9863a

AccessionMI0031654 (change log)
DescriptionAegilops tauschii miR9863a stem-loop
Gene family MIPF0001998; MIR9863
Stem-loop
   uug       a              -                a     uuacauauaagcauauuuuugaaaguuugagagagagaucacaagcagaucccgugca 
5'    ucgcuca uuguuaugaucugc uucucaucugaagacu guuua                                                          g
      ||||||| |||||||||||||| |||||||||||||||| |||||                                                           
3'    agcgagu gauaauacuagaug aagaguagauuucuga caaau                                                          a
   uaa       c              g                a     cgccggguuaccgagaacuucaccuucuuaauaacaucaacaucguuacuacaaggga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr1: 68907222-68907434 [+]
intergenic
Database links

Mature sequence ata-miR9863a-5p

Accession MIMAT0037104
Sequence

13 - 

uguuaugaucugcuucucauc

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR9863a-3p

Accession MIMAT0037105
Sequence

182 - 

ugagaagguagaucauaauagc

 - 203

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).